Home > Parse Error > Parse Error At Line 1 Unmatched Cigar Operation

Parse Error At Line 1 Unmatched Cigar Operation

Since my read is from 454 so I use bwasw for mapping and got sam file. Now i am trying bowtie2 for alignment of my reads and i made ... Why Does Tophat Fail On Me? Sam To Bam I sequenced a mito genome using paired end method on the mi-seq I mapped all the reads back to re... Source

I understand that I can withdraw my consent at any time. I am using command $ samtools view -b -S -o bowtie.glob.bam bowtie.glob.sam, but I am getting the following error: Parse error at line 25645: invalid CIGAR character Could someone please help I am using command $ samtools view -b -S -o bowtie.glob.bam bowtie.glob.sam but getting error Parse error at line 25645: invalid CIGAR character Could someone please help me to solve this scaffold1 4 * 0 0 * * 0 0 55278387 0 - 100 ADD REPLY • link modified 2.8 years ago • written 2.8 years ago by Istvan Albert ♦♦ 66k https://sourceforge.net/p/samtools/mailman/message/28368407/

TCGA Analysis - Generating Count files using htseq Hello Biostars community, I am new to TCGA studies, and I would like to generate count files fro... I am new to RNA seq. Please don't fill out this field. I used this cmd to convert my sam to bam - samtools view -bT hg19.fa s_chip2.sam > s_chip2.bam I got this error.

Seem the problem is from bwasw. The key is the -m 1 (which supercedes -k 1), saying that reads with more than 1 match are not reported. One possible solution is to remove these kind of lines. Table 'N-Reads=F(Duplicate,Sample) ' How Can I Visualize This ?

I have aligned my reads with Bowtie with the com... ADD REPLY • link written 2.8 years ago by Devon Ryan ♦ 57k It is not a cycle - the CIGAR string is also invalid, perhaps your entire SAM file is. alignment samtools sam bam • 1.7k views ADD COMMENT • link • Not following Follow via messages Follow via email Do not follow modified 2.8 years ago by Devon Ryan ♦ I'm trying to align the denovo assembly scaffolds I have generated to the available reference genome.

Parse error at line 2421: unmatched CIGAR operation Aborted My sam file from bwasw is as follow. MuTect2's variants missing QUAL score I was wondering if anyone has had experience with this. Background: I used bwa to create my SAM file. I have been mapping paired-end reads of o...

Tophat Error : Couldn't build bowtie index with err = 1 I used the following command to run tophat  tophat -G $RPATH/ED.gtf -o $RPATH/tophat/E1 ... https://www.biostars.org/p/90436/ But then I use samtools view -bS to convert sam to bam. Why Bam File Been Seperated By Samtools I run the following command using BWA version 0.7.5: # transform the SAM file to BAM ~/bin/samt... Seem the problem is from bwasw. > >Any suggestion will be great. > >Best regards, >Sutada >-------------------------------------------------------------------------- >---- >RSA(R) Conference 2012 >Save $700 by Nov 18 >Register now >http://p.sf.net/sfu/rsa-sfdev2dev1 >_______________________________________________ >Samtools-help

Samtools To Analyze Bwa Output I have a query file with 70,000 lines of sequences and when I do the bwasw each sam output file i... this contact form nilshomer06-15-2010, 09:01 AMAny suggestions for the missing CIGAR? Sam To Bam I sequenced a mito genome using paired end method on the mi-seq I mapped all the reads back to re... output/ [emailprotected]:/host/Users/chris.wall/Desktop/Mastigo-genomics/bwa_cw$ sed '18750816,18750818!d' WC.sam ILLUMINA-2F52BD:6:50:1169:1446#0 163 NODE_37776_length_48465_cov_160.191483\par 35442 29 59M = 35600 217 TTTTATCGGTGTGTATCGGTGTGTATCGGTGGGCGAGTTTTCAACAAGATTATGGGGCA gggfggggfdae[_aee_eeZ_^]_`aaeS]\FY\`dWZ]_^`_`WcSZXg`dgfcbYV XT:A:U NM:i:2 SM:i:0 AM:i:0 X0:i:1 X1:i:2 XM:i:2 XO:i:0 XG:i:0 MD:Z:7T27G23 ILLUMINA-2F52BD:6:50:1169:1947#0 83 NODE_51983_length_172857_cov_173.044144\par 119160 60

No, thanks SEQanswers > Bioinformatics > Bioinformatics > samtools: parse error in SAM to BAM conversion PDA View Full Version : samtools: parse error in SAM to BAM conversion chrisW06-11-2010, 03:05 I had a question regarding the program PScan. converting SAMRecord to JSON or String format I want to develop RESTful web service which will provide bam reads in JSON format. http://kiloubox.com/parse-error/parse-error-at-line-1-invalid-cigar-character.html My command is ....

GPYR5PO02HT2RB.f 0 Scaffold34 978186 203 1S65M1D90M * 0 0 TCACGAAAATACAAATGTAGCGACGTTCTATTCGTTTTATTGGATGCTTGGGCAATGAAATTTCCGTTAAGTTTTAATACCTGCTACTTTGCAGGGCCGAAGAAGCTTTGATGTGTAGTGACAAGGATATTGCCTATCTATTCAAAAGCGAAATAC GHG?;[email protected]@GGIIIIIIIIIIHHIGBAA==>=I22==IIIIIIBB?GEEG?111111A=:--/1B9=77776FIIIIHHHIHGGGGIHEHIA177ADFFG??;;;CGEE????677BE77476???;;;>>;:;:>C8===EEE>>>?7C AS:i:148 XS:i:0 XF:i:3 XE:i:3 XN:i:0 GPYR5PO02ICVBA.r 0 Scaffold139 669741 0 108M1S * 0 0 TTGAAAGCGTTTGCCACCCCCTTTCAACATTGTTGAAACGTGTTGAAAGGATGTTGAATCGATGTTGAAAGAGTTTAAAAGCCTTTAAACTTTGCTTCAACATCCATTA :45<33335BBBFGGIIIIIHFBBBFFHIIHIIHHHIHHHIIICBBEEEIIHGD;[email protected]<9E;;111555BBBBGGIIIIIIIIIIFIII AS:i:108 XS:i:108 XF:i:2 XE:i:0 Building Bowtie index failure Greetings: I am using Tophat2 (command line) to analyze RNA-seq data and I am encountering some e... It just appears to be the first and thus aborts the SAM --> BAM conversion.

Sam To Bam Conversion Reference Fasta File Hello, I had some data in "eland_export.txt" format and I want to convert it to the SAM format f...

Error while conversion of .sam to sorted.sam using samtools Hey hi, I have used BWA for the alignment purpose. Parse error at line 7707082: sequence and quality are inconsistent Aborted I ran ValidateSamFile.jar, a picard tool and got the following error, hundreds of them - WARNING: Read name HWI-ST798R:82: D18MUACXX:2:1101:2025:1987, I got this error message. [samopen] SAM header is present: 2419 sequences. [sam_read1] reference 'GN2FJBZ01ACSDW.r' is recognized as '*'. Problem mapping SOLiD reads with Bowtie1 Hello, Could you please have a look, what goes wrong?

Bowtie Results Not Matching The Expected Error Qualities I stumbled upon this problem when playing with different flags of bowtie. ADD COMMENT • link modified 3.7 years ago • written 3.7 years ago by Ashutosh Pandey ♦ 10k 1 The manual was where I got the solution from... Hi guys. Check This Out ADD REPLY • link written 3.8 years ago by GPR • 270 Please log in to add an answer.

I... Shishir K Gupta Universität Heidelberg Error in Sam to Bam conversion. Parse Many/Multiple .Pdb Files Using Perl Script I am final year bioinformatics student, doing final year project on "Protein Database". Solid / Colorspace with bowtie : ERRO -> Extra parameter(s) specified Hi I'm trying to map colorspace files with bowtie, with follow command: bowtie -C -S /mm9IndexC...

Each line must contain the reference name and the length of the reference, one line for each distinct reference; additional fields are ignored. ADD REPLY • link written 3.6 years ago by Rohit • 620 0 3.7 years ago by Rohit • 620 European union Rohit • 620 wrote: Could you please try: samtools sam to bam conversion Hi I could extract the unmapped reads from the bwa-mem alignment file in SAM format using below ... I have a trinity.fast file I would like to align reads to.

Topics Bioinformatics and Computational Biology × 2,669 Questions 56,397 Followers Follow Next Generation Sequencing × 1,511 Questions 20,590 Followers Follow Feb 27, 2013 Share Facebook Twitter LinkedIn Google+ 0 / 0 I want to extract the lines from these files only if the v... Powered by Biostar version 2.3.0 Traffic: 629 users visited in the last hour For full functionality of ResearchGate it is necessary to enable JavaScript. I downloaded fasta files from NCBI from an SRA ...

GPYR5PO02HT2RB.f 0 Scaffold34 978186 203 1S65M1D90M * 0 0 TCACGAAAATACAAATGTAGCGACGTTCTATTCGTTTTATTGGATGCTTGGGCAATGAAATTTCCGTTAAGTTTTAATACCTGCTACTTTGCAGGGCCGAAGAAGCTTTGATGTGTAGTGACAAGGATATTGCCTATCTATTCAAAAGCGAAATAC GHG?;[email protected]@GGIIIIIIIIIIHHIGBAA==>=I22==IIIIIIBB?GEEG?111111A=:--/1B9=77776FIIIIHHHIHGGGGIHEHIA177ADFFG??;;;CGEE????677BE77476???;;;>>;:;:>C8===EEE>>>?7C AS:i:148 XS:i:0 XF:i:3 XE:i:3 XN:i:0 GPYR5PO02ICVBA.r 0 Scaffold139 669741 0 108M1S * 0 0 TTGAAAGCGTTTGCCACCCCCTTTCAACATTGTTGAAACGTGTTGAAAGGATGTTGAATCGATGTTGAAAGAGTTTAAAAGCCTTTAAACTTTGCTTCAACATCCATTA :45<33335BBBFGGIIIIIHFBBBFFHIIHIIHHHIHHHIIICBBEEEIIHGD;[email protected]<9E;;111555BBBBGGIIIIIIIIIIFIII AS:i:108 XS:i:108 XF:i:2 XE:i:0 Post a few lines of the SAM file (after the header) ADD REPLY • link modified 2.8 years ago • written 2.8 years ago by Istvan Albert ♦♦ 66k Your SAM Powered by Biostar version 2.3.0 Traffic: 629 users visited in the last hour Latest Open RNA-Seq ChIP-Seq SNP Assembly Tutorials Tools Jobs Forum Planet All » View Posts Latest Open about • faq • rss Community Log In Sign Up Add New Post Question: Bowtie Sam Output Not Parsed 0 3.8 years ago by GPR • 270 Mexico GPR • 270