Home > Parse Error > Parse Error At Line 1 Sequence And Quality Are Inconsistent

Parse Error At Line 1 Sequence And Quality Are Inconsistent

Contents

I would experiment with a few lines around the one namedin the error message, looking for an instance where the number of charactersdiffers. Try adding " 2> stderr.txt" to explicitly force the stderr output to a file you can later examine on every command. All Rights Reserved. The command I have used to create the alignment file was - bwa bwasw Pan_troglodytes.fa clint_79_k29.scaf > ref_aln_scaf.sam I always get the following error with the commands ***[samopen] SAM header is Source

Seq.998 looks like this: seq.998 117 chr1 24622579 255 * = 24622579 0 GAGGAAGACATATTATATGAGATTGGCTTGAAACCAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGT XO:A:F IH:i:2 HI:i:2 seq.998 153 chr1 24622579 255 100M = 24622579 0 GTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTA XO:A:F IH:i:2 HI:i:2 This invalid email (thinking…) Reset or sign in with UserVoice password Forgot password? ADD COMMENT • link written 3.4 years ago by Raghav • 100 A BAI index file associated with a BAM file is a like an index of a book, which helps The size of my original Bam file is about 13GB.

Samtools Manual

thanks for any help, mark Re: [Bio-bwa-help] sam->bam: sequence and quality are inconsistent From: Steve Lianoglou - 2011-07-21 22:10:07 Hi, 2011/7/21 Mark Kelly : > Hi, > > I am if your lucky. Well, what does line 1170 look like in your SAM file? InsideDNA: Samtools guide: learning how to filter and manipulate with SAM/BAM files Samtools is a set of utilities that manipulate alignments in the BAM format.

ITMAT Applications member khayer commented May 2, 2012 I just tested the GATK with the modified output. Any other ideas are most welcome. I went all the back to bwa version 0.5.0 as I remembered that I had it working some time ago, and it worked with no problem. ADD COMMENT • link modified 3.4 years ago • written 3.4 years ago by Alex Reynolds ♦ 15k 0 3.4 years ago by Raghav • 100 Allahabad, India Raghav • 100

Myron myronpeto View Public Profile Send a private message to myronpeto Find More Posts by myronpeto 10-29-2013, 02:06 PM #10 Elsie Member Location: Australia Join Date: Mar 2011 So before going to map fastq file it must be pass through quality test and for that purpose Fastx toollit, fastQC and FTQC tools are available, Unfortunately I did not use Richard Finney View Public Profile Send a private message to Richard Finney Find More Posts by Richard Finney 02-02-2012, 03:40 PM #5 myronpeto Member Location: Portland, OR Join Date: Next, Iconverted these 500 SAMs to BAMs using the following command:*samtools view -bS file.sam > file.bam*using samtools version 0.1.18 (r982:295).I could convert 443 out of the SAMs into BAMs without any

Topics covered include: Web security, SSL, hacker attacks & Denial of Service (DoS), private keys, security Microsoft Exchange, secure Instant Messaging, and much more. I can't find it anywhere. > > > > [samopen] SAM header is present: 2957 sequences. > > Parse error at line 3512359: sequence and quality are inconsistent > > createbam.sh: How can I save the output from samtools and awk as a bam file? Contact Us - SEQanswers Home - Archive - Top Powered by vBulletin Version 3.8.9Copyright ©2000 - 2016, vBulletin Solutions, Inc.

Samtools Mpileup

Similar posts • Search » Sam To Bam I sequenced a mito genome using paired end method on the mi-seq I mapped all the reads back to re... https://sourceforge.net/p/samtools/mailman/message/24294049/ Annotation of miRNA from NGS Hello, all I am still working on the DEG analysis of miRNA. Samtools Manual Sir I am unable to interpret this line "... With a BAM file, the index will help you pull out some genomic region you're interested in.

Well, what does line 1170 look like in your SAM file? http://kiloubox.com/parse-error/parse-error-line-2.html Could be that the fastq-file you put in is corrupted at that position, leading to a broken SAM-file. I tried using samtools view on the data piped directly from bwq sampe and also on the sam file I generated. I had included my sed command to extract the line in case I had gotten it wrong.

done [samopen] SAM header is present: 1 sequences. [sam_read1] reference '162546618' is recognized as '*'. I can't find it anywhere. > > [samopen] SAM header is present: 2957 sequences. > Parse error at line 3512359: sequence and quality are inconsistent > createbam.sh: line 1: 10236 Aborted Where possible, you should pipe the output of whatever progam is making your .sam files (like bwa sampe, in your case) straight into samtools view. have a peek here Well, what does line 1170 look like in your SAM file?

Indexing changed with 0.6.0. After looking ... This makes it hard to see onthe screen exactly how many characters there are.- tom blackwell -Post by Thorhildur JuliusdottirDear all,I generated 500 .SAM files with BWA (version0.6.1-r104).

Is there something obviously wonky about it? -- Steve Lianoglou Graduate Student: Computational Systems Biology | Memorial Sloan-Kettering Cancer Center | Weill Medical College of Cornell University Contact Info: http://cbio.mskcc.org/~lianos/contact ------------------------------------------------------------------------------

I understand that I can withdraw my consent at any time. Create a password I agree to the terms of service Signed in as (Sign out) Close Close Post comment Submitting... My sam file after headers looks like this - scaffold1 4 * 0 0 * * 0 0 55278387 0 - 100 #DOWN 68667525:5:56 68667525 127 + 556 #DOWN 63995574:5:107 60040051:2:45 Single Sign On provided by vBSSO SourceForge Browse Enterprise Blog Deals Help Create Log In or Join Solution Centers Go Parallel Resources Newsletters Cloud Storage Providers Business VoIP Providers Internet Speed

Terms Privacy Opt Out Choices Advertise Get latest updates about Open Source Projects, Conferences and News. But I have a problem when I use samtools to convert the sam files into bam inorder to check the statistics. Please don't fill out this field. Check This Out ADD REPLY • link written 3.3 years ago by William • 3.5k 5 3.3 years ago by John Marshall • 800 Cambridge, United Kingdom John Marshall • 800 wrote: The problem

I want to compare myself to anothe... Parse warning at line 2: mapped sequence without CIGAR Parse error at line 2: sequence and quality are inconsistent Program received signal SIGABRT, Aborted. 0x00007fff91ff7d46 in __kill () (gdb) backtrace #0 I can't find it anywhere. [samopen] SAM header is present: 2957 sequences. how does the SAM file EOF marker look like?

Cheerrs Kevin On Mon, Jan 4, 2010 at 11:12 PM, Gai, Xiaowu wrote: > I recently ran into the same problem, Heng. ADD REPLY • link written 3.4 years ago by Philipp Bayer ♦ 3.7k Dear Sir Philipp, I got what you want to say here, it might be possible that there may Type "show warranty" for details. Please don't fill out this field.

CIGAR and query sequence are of different length when trying to convert from sam to bam? Parse error at line 38967971: sequence and quality are inconsistent Aborted it generated approximately 1gb file then aborted how to over come this error?? is there a quick bash trick to just output the line fast I only know to use less then grep or go to line number. Maybe it would be useful to try to troubleshoot that path.

Here is the stripped-down program.... #include #include "sam.h" int main(int argc, char **argv) { samfile_t *sam = samopen(argv[1], "r", NULL); if(sam == NULL) { fprintf(stderr, "file open error: '%s'\n", argv[1]);