Home > Parse Error > Parse Error At Line 1 Missing Colon In Auxiliary Data

Parse Error At Line 1 Missing Colon In Auxiliary Data

Contents

Ankur anaqib2 View Public Profile Send a private message to anaqib2 Find More Posts by anaqib2 « Previous Thread | Next Thread » Thread Tools Show Printable Version Email this Parse error at line 85: missing colon in auxiliary data Aborted (core dumped) Here is that line (85): HWI-ST1097:95:D0U82ACXX:7:1101:1400:2239 16 X 38482098 60 101M * 0 0 CTCTGCAAAATGATATGCAAGTATTAGTTGTGTGTATATTTCTGTTTGTTTGGGATAGCCTTGCCTACTGAAGAGCATAAGAAGCTGGGTTTCTCCTCATT ######################################@=39ABC;>B;D8?0?09*?109D:11*11::1*:22+AC?C<3+3?A:+CD?>BD>DADSource

Thread view [Bio-bwa-help] missing colon in auxiliary data From: Cantarel, Brandi L. - 2014-01-02 22:28:34 Attachments: Message as HTML I am trying to use samtools to convert sam to bam. i am not so similar with the terminology. The corrupted system files entries can be a real threat to the well being of your computer. My SAM-file has a header: @SQ    SN:2L    AS:FlyBase r5    LN...

Samtools Parse Error At Line 1

Using the [ code ] tags (via the # icon in the forum's advanced editor), that's: Code: HISEQxxxxx#NGACCA 4 * 0 0 * * 0 0 * * AS Column 12 Thank you for your time. Hope this helps noms View Public Profile Send a private message to noms Find More Posts by noms 02-07-2013, 05:09 AM #9 visserm Junior Member Location: South Africa SEQanswers > Bioinformatics > Bioinformatics error with sam output ->Parse error at line xxxxx: missing colon in auxiliary data User Name Remember Me?

Parse error at line 95: missing colon in auxiliary data Aborted head -96 file.sam | tail -5 @SQ SN:chrUn_gl000226 LN:15008 @SQ SN:chr18_gl000207_random LN:4262 @RG ID: LB: SM: PL:ILLUMINA D3B4KKQ1:406:H0YE0ADXX:2:1101:1198:2135 89 chr8 The time now is 03:40 PM. samtools view -bS file.sam > file.bam and got the following error... [samopen] SAM header is present: 17 sequences. [sam_read1] reference '4' is recognized as '*'. Samtools View Thanks On Fri, Jul 5, 2013 at 5:19 AM, John Marshall wrote: > On 5 Jul 2013, at 04:45, jbr950 wrote: > > samtools view -bS file.sam > file.bam >

Click here follow the steps to fix Parse Error At Line 1 Missing Colon In Auxiliary Data and related errors. Samtools Help needed: index seg fault after reheader Hi,    I have this SAM file which has two MT entries (bolded) as follows; @SQ    SN:MT    LN... Thanks! https://sourceforge.net/p/bio-bwa/mailman/message/31803286/ Where 0.5.9rc1 wrote an empty RG:Z: > field on the SAM records, I think current versions of bwa would in this > case emit the same @RG header but leave the

Thanks. Bwa Convert SAM to BAM Hello! The line numbersgiven in the error message almost certainly count records ( = lines )in the .sam file. The AS tag is normally the alignment score, and should be something like AS:i:123 instead (i for integer).

W Sam_read1 Parse Error At Line

Sam To Bam I sequenced a mito genome using paired end method on the mi-seq I mapped all the reads back to re... Probably they start with 1 rather than zero; maybethey include the header block, maybe not. Samtools Parse Error At Line 1 About Us Contact us Privacy Policy Terms of use [main_samview] Truncated File. There are two (2) ways to fix Parse Error At Line 1 Missing Colon In Auxiliary Data Error: Advanced Computer User Solution (manual update): 1) Start your computer and log

Extracted the chrM portion of bam into a new bam with header Hello,  I used  samtools view -b -h exome.bam chrM > extractedchrM.bam to extract the mito... this contact form If you're setting this via bwa, it > would be interesting to see the relevant bwa command line (and what version > of bwa you're using). > > John > > Any ideas how to rectify this? If it is the case how can I tell Bowtie not to included such reads in the SAM file in order for me to be able to generate the BAM file? Missing Sam Header

Unless there is another step in your pipeline setting it, the read group tag is set via bwa's -r option (or -R for bwa mem) and it's not obvious how you've The problem is that I was trying to create a .sam file directly (or without using samse/pe). How to easily fix Parse Error At Line 1 Missing Colon In Auxiliary Data error? have a peek here Am I right?

You seem to have CSS turned off. This is technically invalid in the current SAM specification (though there is no real reason for disallowing it, and I would mildly advocate for relaxing that), and samtools rejects it. Next, I*samtools view -bS file.sam > file.bam*using samtools version 0.1.18 (r982:295).I could convert 443 out of the SAMs into BAMs without any complaints, butget 5 different error messages for the remaining

R: Write a SAM file I have a SAM file, created by Bowtie2, that contains a lot of reads.

Find More Posts by maubp 11-25-2013, 01:50 PM #12 anaqib2 Junior Member Location: Chicago Join Date: Nov 2013 Posts: 3 Hi Hi maubp i found the issue. See below for information. Re: [Bio-bwa-help] missing colon in auxiliary data From: Cantarel, Brandi L. - 2014-01-02 22:49:16 Attachments: Message as HTML Looks like I have the pleasure of answering my own question — You seem to have CSS turned off.

Similar posts • Search » Gatk Error At Countcovariate Tool: Bad Input- Could Not Find Any Usable Data In Input Bam Hi, I am running exome analysis using BWA, samtools, picard, basic features: (repairs system freezing and rebooting issues , start-up customization , browser helper object management , program removal management , live updates , windows structure repair.) Recommended Solution Links: (1) Baylor Health Care System, its subsidiaries, and affiliates hereby claim all applicable privileges related to this information. Check This Out I don't k...

ADD COMMENT • link written 3.3 years ago by John Marshall • 800 @jbr950 posted the command line in question to bio-bwa-help, and the problem turned out to be a mistake efoss Bioinformatics 17 12-03-2015 04:28 AM error in picard (SAM validation error) dongshenglulv Bioinformatics 3 07-05-2013 12:58 PM samtools: parse error in SAM to BAM conversion chrisW Bioinformatics 12 01-14-2013 06:16 I wrote an R script to sort ... Thanks!

Re: [Bio-bwa-help] error on samtools view From: jbr950 - 2013-07-05 14:54:23 Attachments: Message as HTML Yes, I couldn't parse the error at first, and now this is seeming very clear. Empty SomaticSniper Output Files Hi all, I have a pipeline which I have written in python to do SNP calling and annotation.  The ... Please don't fill out this field. Start your 15-day FREE TRIAL of AppDynamics Pro!

Picard-tools mark duplicates error, missing @RG Hi, Im trying to mark duplicates using picard tools but have come accross this error:   Excepti... This code is used by the vendor to identify the error caused. There can be many events which may have resulted in the system files errors. This is technically invalid in the current SAM specification (though there is no real reason for disallowing it, and I would mildly advocate for relaxing that), and samtools rejects it.

Blackwell 2013-02-05 12:43:10 UTC Thomas W. Mapping to the transcriptome using Bowtie - am I doing it right? Hope some-body can help me Marike visserm View Public Profile Send a private message to visserm Find More Posts by visserm 11-25-2013, 09:26 AM #10 anaqib2 Junior Member Sign up for the SourceForge newsletter: I agree to receive quotes, newsletters and other information from sourceforge.net and its partners regarding IT services and products.

Parse error at line 27: unmatched CIGAR operation Abort trap: 6 On inspection of lane 27 I saw that the entry for the read had information missing, shifting the layout of error in samfile header I am getting an error in Picard using a modified bed file that was generated using.  I apologize ... However the real problem is to track down what's gone wrong with $name -- especially if you have a lot of BAM files, having the data within be self-identifying is rather Empty > header fields as in your faulty-looking @RG header are also technically > invalid, though samtools is not detecting that. > > Unless there is another step in your pipeline

about • faq • rss Community Log In Sign Up Add New Post Question: Error Calling Samtools View On Bwa Sam Output 0 3.3 years ago by jbr950 • 0 jbr950 Disclaimer: This website is not affiliated with Wikipedia and should not be confused with the website of Wikipedia, which can be found at Wikipedia.org. My reference genome is Human hg19. Igv Not Recognizing Samtools Sorted And Indexed Files.